Previous Article | Next Article 
Journal of Bacteriology, January 2006, p. 450-455, Vol. 188, No. 2
0021-9193/06/$08.00+0 doi:10.1128/JB.188.2.450-455.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Genetic Characterization of a Single Bifunctional Enzyme for Fumarate Reduction and Succinate Oxidation in Geobacter sulfurreducens and Engineering of Fumarate Reduction in Geobacter metallireducens
Jessica E. Butler,*
Richard H. Glaven,
Abraham Esteve-Núñez,¶
Cinthia Núñez,
Evgenya S. Shelobolina,
Daniel R. Bond,
and
Derek R. Lovley
Department of Microbiology, University of Massachusetts, Amherst, Massachusetts 01003
Received 9 September 2005/
Accepted 18 October 2005
 |
ABSTRACT
|
|---|
The mechanism of fumarate reduction in Geobacter sulfurreducens was investigated. The genome contained genes encoding a heterotrimeric fumarate reductase, FrdCAB, with homology to the fumarate reductase of Wolinella succinogenes and the succinate dehydrogenase of Bacillus subtilis. Mutation of the putative catalytic subunit of the enzyme resulted in a strain that lacked fumarate reductase activity and was unable to grow with fumarate as the terminal electron acceptor. The mutant strain also lacked succinate dehydrogenase activity and did not grow with acetate as the electron donor and Fe(III) as the electron acceptor. The mutant strain could grow with acetate as the electron donor and Fe(III) as the electron acceptor if fumarate was provided to alleviate the need for succinate dehydrogenase activity in the tricarboxylic acid cycle. The growth rate of the mutant strain under these conditions was faster and the cell yields were higher than for wild type grown under conditions requiring succinate dehydrogenase activity, suggesting that the succinate dehydrogenase reaction consumes energy. An orthologous frdCAB operon was present in Geobacter metallireducens, which cannot grow with fumarate as the terminal electron acceptor. When a putative dicarboxylic acid transporter from G. sulfurreducens was expressed in G. metallireducens, growth with fumarate as the sole electron acceptor was possible. These results demonstrate that, unlike previously described organisms, G. sulfurreducens and possibly G. metallireducens use the same enzyme for both fumarate reduction and succinate oxidation in vivo.
 |
INTRODUCTION
|
|---|
Geobacter species are environmentally significant, in part because of their ability to anaerobically oxidize acetate to carbon dioxide with the reduction of extracellular electron acceptors such as Fe(III) and Mn(IV) oxides (27, 29), humic substances (24), U(VI) (28), and graphite electrodes (2). Some Geobacter species, including Geobacter sulfurreducens, are also able to use the tricarboxylic acid (TCA) cycle intermediate fumarate as an electron acceptor, catalyzing the two-electron reduction of fumarate to succinate (26), a process that is well understood for other organisms (15). It has previously been shown that the fumarate reductase activity of G. sulfurreducens is membrane bound and is sensitive to the menaquinol analog HOQNO (2-n-heptyl-4-hydroxyquinoline-N-oxide) (8), suggesting that the fumarate reductase might be more like those found in Wolinella succinogenes and Escherichia coli than to the soluble periplasmic enzyme found in the other well-studied Fe(III)-reducing organism Shewanella oneidensis (4, 14, 30).
To completely oxidize acetate with Fe(III) as the electron acceptor, Geobacter species require the membrane-bound TCA cycle enzyme that catalyzes the reverse reaction, succinate dehydrogenase (5, 8). The redox potential of the succinate/fumarate couple (+30 mV) is such that ubiquinone (+110 mV) is the energetically favorable electron acceptor for succinate oxidation, whereas menaquinol (80 mV) is the favorable electron donor for fumarate reduction (15). In E. coli, two separate enzymes are expressed with two different quinones: succinate dehydrogenase and ubiquinone during aerobic growth and fumarate reductase and menaquinone during anaerobic growth (4). In Geobacter species, the mechanisms and energetics of the fumarate reductase and succinate dehydrogenase reactions are less clear. Depending on the electron acceptor, fumarate reductase and succinate dehydrogenase can be required during anaerobic oxidation of acetate, and Geobacter species have been shown to contain only menaquinone, not ubiquinone (3, 25).
It is demonstrated here that G. sulfurreducens has only one enzyme, FrdCAB, that functions in vivo as both the fumarate reductase and the succinate dehydrogenase, with an apparent energetic cost when catalyzing succinate oxidation. G. metallireducens is also shown to contain orthologous frdCAB genes, and evidence is presented that suggests that the presence of a dicarboxylic acid transporter is the key adaptation which allows G. sulfurreducens to use fumarate as a terminal electron acceptor, compared to G. metallireducens, which cannot.
 |
MATERIALS AND METHODS
|
|---|
Cell growth.
G. sulfurreducens strain DL1 was obtained from our laboratory culture collection and cultivated anaerobically at 30°C in a freshwater fumarate or Fe(III) citrate medium as previously described (3, 27). Growth was monitored by optical density or epifluorescence microscopy, and Fe(III) reduction was assessed as accumulation of Fe(II) as previously described (19).
Northern analysis.
Total RNA was isolated with the RNeasy kit (QIAGEN, Inc.), separated by 1.8% denaturing gel electrophoresis, and transferred to a charged nylon membrane with Turboblotter (Schleicher & Schuell, Dassel, Germany). The frdA probe was amplified with the primers FrdA1 (GAACTCGGTTACAACGTTG) and FrdA2 (GTCACCATGCTGCGGAATGC) and labeled with [
-32P]dCTP (New England Nuclear, Boston, MA) by using the NEBlot kit (New England Biolabs).
Construction of an frdA-deficient mutant strain.
Single-step gene replacement of frdA was performed as previously described (19, 22). The upstream region of the gene was amplified with primers FrdA01 (CAACGACAAGTCACTTC) and FrdA02 (GAGCTACGCACTGATCGATG) and the downstream region was amplified with primers FrdA05 (GCAAGAAATCGGTTGAGG) and FrdA06 (GACATGAAGGGTAAGAGTC). The kanamycin resistance cassette from pBBR1MCS-2 (13) was amplified with primers FrdA03 (CATCGATCAGTGCGTAGCTCACAGCAAGCGAACCGGAATTG) and FrdA04 (CCTCAACCGATTTCTTGCATTTCGAACCCCAGAGTC). Recombinant PCR was carried out as previously described (22), except that the annealing temperature was 53°C. Electrocompetent cells were prepared, cells were electroporated, and mutants were isolated as previously described (6), with the exception that the recovery and plating media used Fe(III) citrate media supplemented with 0.2% yeast extract, 0.25 mM cysteine, and 400 µg/ml kanamycin. Gene disruption was confirmed with two PCR amplifications of the region using primers FrdA01/FrdA06 and FrdA03/FrdA04, and one positive clone was chosen as the representative mutant strain.
Expression of dcuB in G. metallireducens.
The fumarate transporter dcuB was cloned from G. sulfurreducens with primers RGBB1 (GCGATGAATTCAAGGGGAGGCAGTTATGATG) and RGBB2 (CGCTGCCCTTCTTTTACAGCACGAACTG). The product was end filled, digested with EcoRI, and ligated into pRG5 (12) that had been digested with HindIII, end filled, and digested with EcoRI. Preparation of electrocompetent G. metallireducens was as previously described for G. sulfurreducens (6), except cells were grown and recovered in Fe(III) citrate media with 0.1% yeast extract, and the wash buffer contained 1.0 mM HEPES (pH 7.0), 1.5 mM MgCl2, 225 mM sucrose, and 1% glycerol. A single colony of G. metallireducens carrying pRG5dcuB was recovered with the roll-tube method (10). The isolated strain was confirmed as G. metallireducens by sequencing the 16S rRNA gene PCR product amplified with primers 338F and 907R (1, 18), and the presence of pRG5dcuB was confirmed by sequencing dcuB amplified with primers RGG1 and RGG2 from plasmid DNA purified from the strain G. sulfurreducens carrying the pRG5dcuB plasmid, as previously described (6).
Enzyme assays.
Cell extract preparation and enzyme assays were carried out anoxically on cultures that had been grown in acetate-Fe(III) citrate medium supplemented with 20 mM fumarate. Cells were washed twice with 50 mM HEPES (pH 7.5) containing 10% glycerol, 2.5 mM MgCl2, and 2.5 mM dithiothreitol, and resuspended in a small volume of the same buffer supplemented with DNase I and lysozyme. Cells were lysed with a French press at 40,000 kPa and centrifuged for 20 min at 1,500 x g at 4°C, with the resulting crude cell extract used in the assays. The assay buffer contained 50 mM HEPES (pH 7.5), 2.5 mM MgCl2, and either 5 mM benzyl viologen [reduced with Ti(III) citrate] or 0.5 mM 2,6-dichloroindophenol. Activity was measured at 578 nm in a 1.0-ml volume of buffer at 30°C. Fumarate reductase activity was measured by following the benzyl viologen absorbance decrease (
= 7.8 mM1 cm1) after the addition of fumarate, and succinate dehydrogenase activity by the 2,6-dichloroindophenol absorbance decrease (
= 21 mM1 cm1) after the addition of succinate (21). Protein concentrations were determined with the bicinchoninic acid method (36).
Metabolite analysis.
Samples for organic acid analysis were filtered (0.2-µm pore diameter) and stored in 0.5 N HCl at 80°C. Samples were separated by high-pressure liquid chromatography (Aminex HPX-87H column, 300 x 7.8 mm; Bio-Rad Laboratories, Hercules, CA) with a mobile phase of 10.0 mM H2SO4 flowing at 0.6 ml/min, with detection at 215 nm. Peaks were identified and quantified based on standards of acetate, fumarate, succinate, and malate.
Nucleotide sequence accession numbers.
The frdCAB open reading frames were given the NCBI accession numbers NP_952229, NP_952230, and NP_952231.
 |
RESULTS AND DISCUSSION
|
|---|
Identification and analysis of the FrdCAB operon.
The complete G. sulfurreducens genome (31) was searched with sequences of subunits from each of the different classes of fumarate reductases and succinate dehydrogenases (20). A single putative operon with three open reading frames was identified and designated frdCAB (Fig. 1A). There were no genes homologous to the periplasmic flavocytochrome fumarate reductases found in Shewanella species (30, 37). Comparison of the proteins encoded by the G. sulfurreducens operon to the heterotrimeric, or B-type, fumarate reductase from W. succinogenes, for which the structure has been solved (16), showed orthologs to the catalytic subunit, FrdA, with conserved flavin adenine dinucleotide and dicarboxylate binding residues; the Fe-S cluster subunit, FrdB, with three conserved cysteine-rich motifs; and the membrane anchor subunit, FrdC, with all five putative transmembrane helices (data not shown). Four conserved histidines, which have been shown to bind two b-type hemes in W. succinogenes (16), were also identified in the FrdC sequence. The succinate dehydrogenase of the gram-positive aerobe Bacillus subtilis is also a member of this B-type family of enzymes (20), and the G. sulfurreducens FrdCAB proteins are more similar to this enzyme (31% amino acid identity between A subunits) than to the fumarate reductases found in other Proteobacteria, such as W. succinogenes (23%) and H. pylori (20%).

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 1. Structure and mutagenesis of the fumarate reductase/succinate dehydrogenase operon of G. sulfurreducens. (A) The operon structure of the genes, GSU1176 (frdC), GSU1177 (frdA), and GSU1178 (frdB), showing the location (black bar) of the gene disruption with the kanamycin resistance cassette in the mutant strain. The homologous genes in G. metallireducens are organized and spaced identically, with 85%, 93%, and 91% amino acid sequence identity between the C, A, and B subunits, respectively. (B) Transcription of the operon in G. sulfurreducens grown with fumarate as electron acceptor, analyzed by Northern blot (10 µg RNA/lane) using a fragment of frdA as a probe. The expected size of a transcript of frdCAB is 3.3 kb and that of frdAB is 2.6 kb.
|
|
Although the G. sulfurreducens gene products are similar to these well-studied heterotrimeric enzymes, they form a distinct phylogenetic group with proteins from diverse organisms, including Cytophaga-Flavobacterium-Bacteroides, green sulfur, high-GC gram-positive cyanobacteria and spirochete species (Fig. 2). This grouping is supported by phylogenetic analysis for each of the three subunits, with the membrane-bound FrdC subunit being the least conserved (data not shown).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2. Phylogenetic tree of representative catalytic subunits from putative B-type, heterotrimeric enzymes which were most similar to G. sulfurreducens. Sequences were aligned using Clustal X (38), and distances and branching order were determined using the neighbor-joining method (32). A total of 1,000 replicates were used for bootstrap analysis. The clade containing the W. succinogenes fumarate reductase is indicated by FrdA and the clade containing the B. subtilis succinate dehydrogenase is indicated by SdhA. Geobacter species subunits are shown in bold.
|
|
Northern blot analysis was performed to determine whether the frdCAB cluster constituted an operon. When a fragment of frdA was used as a probe, two bands of 3.8 kb and 2.7 kb were detected in cells grown with either fumarate or Fe(III) as the electron acceptor and acetate as the sole carbon and energy source (Fig. 1B). Thus, expression of the frdCAB enzyme is not specific to conditions under which a terminal fumarate reductase is required. When a fragment of frdC was used as a probe, a single 3.8-kb band was detected (data not shown). The size of the larger band is consistent with cotranscription of all three genes, and the size of the smaller band is consistent with the size of frdAB. Two transcript sizes have also been reported in Paenibacillus macerans and E. coli (33, 40).
Dual function of FrdCAB as the fumarate reductase and the succinate dehydrogenase.
To determine the in vivo role of the enzyme encoded by this operon, the gene for the putative catalytic subunit, frdA, was mutated by insertion of a kanamycin resistance cassette, with concurrent deletion of 57% of the gene (Fig. 1A). The mutant strain was isolated using Fe(III) as the electron acceptor and hydrogen as the electron donor with acetate as the carbon source. The frdA-deficient strain did not grow with fumarate as the electron acceptor in solid or liquid medium with acetate, hydrogen, or both provided as the electron donor(s) (data not shown), and there was no detectable fumarate reductase activity in crude cell extracts of the mutant strain, compared to 123 ± 17.8 nmol min1 mg protein1 in extracts of the wild type.
In addition, the frdA-deficient strain did not grow with Fe(III) as the electron acceptor when acetate was the electron donor (Fig. 3B), a growth condition under which no fumarate reductase activity should be required. This result supports the Northern blot analysis showing that the enzyme in expressed when Fe(III) is the terminal electron acceptor and suggests that the enzyme may also function as the succinate dehydrogenase required for acetate oxidation via the TCA cycle. This hypothesis was confirmed by determining the succinate dehydrogenase enzymatic activity in the mutant strain. There was no detectable succinate dehydrogenase activity in cell extracts of the mutant strain, compared to 55 ± 7.0 nmol min1 mg protein1 in the wild type.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3. Growth of wild-type and frdA-deficient G. sulfurreducens strains with excess acetate as the electron donor and Fe(III) as the electron acceptor. (A) Cell growth and Fe(III) reduction of the wild type with 20 mM fumarate supplementation and with no fumarate supplementation. (B) Cell growth and Fe(III) reduction of the frdA-deficient strain with 20 mM fumarate supplementation and with no fumarate supplementation. Experiments were run in parallel with inocula of ca. 6 x 106 late-log-phase cells adapted to the appropriate medium. Data are means ± standard deviations of triplicate cultures.
|
|
It was previously hypothesized that succinate dehydrogenase activity might not be necessary when fumarate served as the electron acceptor for G. sulfurreducens, because exogenous fumarate could serve as the substrate for malate and oxaloacetate synthesis (8). In accordance with this hypothesis, adding fumarate to acetate-Fe(III) medium permitted the frdA-deficient strain to grow with acetate as the electron donor and Fe(III) as the electron acceptor despite the lack of succinate dehydrogenase activity (Fig. 3B). Thus, unlike previously studied organisms, G. sulfurreducens uses a single enzyme as both the terminal fumarate reductase in anaerobic respiration and the succinate dehydrogenase in acetate oxidation via the TCA cycle. Although previously described fumarate reductases and succinate dehydrogenases typically catalyze both fumarate reduction and succinate oxidation in vitro, these enzymes have been found to catalyze the reaction in just one direction in vivo (4, 9, 14, 17).
Energetic cost of the succinate dehydrogenase reaction.
Both wild-type and mutant strains growing in Fe(III) medium with excess acetate as the electron donor grew faster when supplemented with fumarate (8.3 ± 0.4 and 7.6 ± 0.4 h generation time, respectively) compared to wild type growing without fumarate supplementation (9.5 ± 0.1 h generation time) (Fig. 3). Furthermore, the peak cell density was more than 1.6-fold higher in the fumarate-supplemented strains than in unsupplemented wild type (Fig. 3). In the case of the wild type, these increases in growth rate and cell yield could be due to the simultaneous exploitation of two terminal electron acceptors, fumarate and Fe(III), allowing the oxidation of more acetate, leading to the generation of more ATP. Examination of the organic acid content of the growth medium from the fumarate-supplemented wild-type cultures showed that the wild-type strain did exploit both electron acceptors and continued to oxidize acetate and convert fumarate to succinate after the depletion of Fe(III) (by 40 h) (Fig. 4A). Malate accumulated when fumarate was in excess, which is consistent with the activity of the reversible fumarase in G. sulfurreducens (8) and the lack of a glyoxylate shunt in this species (31).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4. Metabolism of organic acids in wild-type and frdA-deficient G. sulfurreducens strains grown with excess acetate as the electron donor and Fe(III) as the electron acceptor. Data are means of analyses by high-pressure liquid chromatography of the fumarate supplemented cultures shown in Fig. 3. (A) Metabolism of acetate, fumarate, succinate, and malate in the wild-type strain. (B) Metabolism of acetate, fumarate, succinate, and malate in the frdA-deficient mutant strain. Samples were taken from the triplicate cultures at the same time as those from Fig. 3.
|
|
However, the mutant strain cannot generate ATP via fumarate reduction, so the use of two electron acceptors does not account for the increases in growth rate and cell yield (Fig. 3B). Examination of the organic acid content of the growth medium from the fumarate supplemented frdA-deficient strain confirmed that acetate oxidation and succinate production ceased when Fe(III) was depleted (by 40 h) (Fig. 4B). This is consistent with a strict dependence of the succinate production on the TCA cycle in this strain (Fig. 5B).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 5. A model for succinate production during growth with fumarate supplementation in the wild-type and frdA-deficient G. sulfurreducens strains. (A) In the wild-type strain, succinate can be produced by both the terminal fumarate reductase, FrdCAB, and by the TCA cycle reactions. Succinate can be exchanged with fumarate from external media, obviating the need for a succinate dehydrogenase. (B) In the frdA-deficient mutant strain, neither a terminal fumarate reductase nor a succinate dehydrogenase is present, so succinate is produced only by the TCA cycle reactions and must be exchanged with external fumarate to allow continued acetate oxidation.
|
|
The increases in growth rate and cell yield during bypass of the succinate dehydrogenase (Fig. 3A) indicate that there is an energetic cost for this reaction. This could be due to the unfavorable coupling of the oxidation of succinate (+30 mV) with the reduction of menaquinone (80 mV), the only membrane-bound electron carrier in Geobacter species (3, 25). In B. subtilis, the succinate dehydrogenase is orthologous to FrdCAB from G. sulfurreducens, and the membrane-bound electron carrier is also menaquinone (9). Dissipation of the membrane potential has been proposed to drive succinate oxidation in B. subtilis (34, 35). In G. sulfurreducens, a succinate dehydrogenase that dissipates the membrane potential could explain the increases in cell yield and growth rate seen when the succinate dehydrogenase is bypassed (Fig. 3A). This also provides insight into the decreases in growth rate and cell yield previously observed in wild-type G. sulfurreducens growing with Fe(III) citrate as the electron acceptor compared to fumarate as the electron acceptor (7). This decrease is unexpected, because the midpoint potential of the fumarate/succinate redox couple (+30 mV) is lower than that of the Fe(III)/Fe(II) citrate couple (+370 mV). Because the succinate dehydrogenase is required if exogenous fumarate is not present, the lower cell yield during growth with Fe(III) serving as the electron acceptor may be due in part to the cost of succinate oxidation. The proton translocation stoichiometry of other parts of the electron transport chain to Fe(III) is currently under investigation.
Engineering G. metallireducens to grow on fumarate.
Unlike G. sulfurreducens, the closely related species G. metallireducens cannot grow with fumarate as the sole electron acceptor (Fig. 6). However, analysis of the draft genome of G. metallireducens identified a single putative operon (NCBI accession numbers ZP_00300178, ZP_00300178, and ZP_00300180) with ca. 90% identity to frdCAB of G. sulfurreducens (Fig. 1A). Since fumarate is reduced in the cytoplasm in G. sulfurreducens (8), the genome was also searched for genes homologous to known fumarate transporters. While the G. sulfurreducens genome contained an open reading frame (NCBI accession number NP_953796) whose product has 43% amino acid identity to a fumarate transporter protein, DcuB, found in W. succinogenes (NCBI accession number CAA10331) (39), no open reading frame with similarity to known dicarboxylate transporters (11) was found in G. metallireducens. To determine if lack of fumarate transport was the cause of the inability of G. metallireducens to grow with fumarate as the terminal electron acceptor, a copy of the G. sulfurreducens dcuB gene was constitutively expressed in G. metallireducens in trans. The G. metallireducens strain expressing dcuB was able to grow with fumarate as the sole electron acceptor with a generation time similar to that of the G. sulfurreducens strain expressing dcuB, 8.5 versus 8.4 h, with a somewhat shorter lag time and a slightly higher maximum optical density (Fig. 6). Thus, the primary role of this FrdCAB in G. metallireducens is likely to serve as the succinate dehydrogenase of the TCA cycle, but the presence of fumarate in the cell allows fumarate reduction as well, possibly by a mechanism similar to that shown in Fig. 5A. The conversion of G. metallireducens to a fumarate-respiring microorganism represents the first genetic engineering of this strain and the first engineering of a Geobacter species to expand its respiratory capabilities.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6. Growth of G. metallireducens and G. sulfurreducens with excess acetate as the electron donor and fumarate as the sole electron acceptor. Shown are wild-type G. metallireducens and strains of G. metallireducens and G. sulfurreducens in which dcuB, the putative fumarate transporter from G. sulfurreducens, is being constitutively expressed in trans. Inocula were 2.5% late-log-phase cells adapted to the appropriate medium, with the strains carrying pRGdcuB grown in the presence of 275 µM spectinomycin. Data are means ± standard deviations of triplicate cultures.
|
|
Implications.
In summary, the results show that the FrdCAB enzyme of G. sulfurreducens acts as both the terminal fumarate reductase and the succinate dehydrogenase of the TCA cycle in vivo, with an apparent energetic cost when catalyzing succinate oxidation. It is similar to the fumarate reductase of W. succinogenes and the succinate dehydrogenase of B. subtilis, but the apparent role of the enzyme in G. metallireducens and the low availability of exogenous fumarate in the sedimentary environments in which these species predominate (23) indicate its primary function in both Geobacter species is likely to serve as a succinate dehydrogenase.
 |
ACKNOWLEDGMENTS
|
|---|
This research was supported by the Office of Science (BER), U.S. Department of Energy, Genomics:GTL program, DE-FC02-02ER63446. A.E.N. was the recipient of a postdoctoral fellowship from the Secretaría de Estado de Educación y Universidades (Spain), co-funded by the European Social Fund.
We are grateful for the technical support from Kimberly Manley.
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Department of Microbiology, 203 Morrill Science Center IVN, University of MassachusettsAmherst, Amherst, MA 01003. Phone: (413) 545-2747. Fax: (413) 545-1578. E-mail: jbutler{at}microbio.umass.edu. 
¶ Present address: Centro de Astrobiología, Instituto Nacional de Técnica Aerospacial, Madrid, Spain. 
Present address: Departamento de Microbiologia Molecular, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Morelos, Mexico. 
Present address: Department of Geology and Geophysics, University of Wisconsin, Madison, Wis. 
Present address: Department of Microbiology, Biotechnology Institute, University of Minnesota, St. Paul, Minn. 
 |
REFERENCES
|
|---|
- Amann, R. I., W. Ludwig, and K. H. Schleifer. 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59:143-169.[Abstract/Free Full Text]
- Bond, D. R., D. E. Holmes, L. M. Tender, and D. R. Lovley. 2002. Electrode-reducing microorganisms that harvest energy from marine sediments. Science 295:483-485.[Abstract/Free Full Text]
- Caccavo, F., Jr., D. J. Lonergan, D. R. Lovley, M. Davis, J. F. Stolz, and M. J. McInerney. 1994. Geobacter sulfurreducens sp. nov., a hydrogen- and acetate-oxidizing dissimilatory metal-reducing microorganism. Appl. Environ. Microbiol. 60:3752-3759.[Abstract/Free Full Text]
- Cecchini, G., I. Schroder, R. P. Gunsalus, and E. Maklashina. 2002. Succinate dehydrogenase and fumarate reductase from Escherichia coli. Biochim. Biophys. Acta 1553:140-157.[Medline]
- Champine, J. E., and S. Goodwin. 1991. Acetate catabolism in the dissimilatory iron-reducing isolate GS-15. J. Bacteriol. 173:2704-2706.[Abstract/Free Full Text]
- Coppi, M. V., C. Leang, S. J. Sandler, and D. R. Lovley. 2001. Development of a genetic system for Geobacter sulfurreducens. Appl. Environ. Microbiol. 67:3180-3187.[Abstract/Free Full Text]
- Esteve-Nunez, A., M. Rothermich, M. Sharma, and D. Lovley. 2005. Growth of Geobacter sulfurreducens under nutrient-limiting conditions in continuous culture. Environ. Microbiol. 7:641-648.[CrossRef][Medline]
- Galushko, A. S., and B. Schink. 2000. Oxidation of acetate through reactions of the citric acid cycle by Geobacter sulfurreducens in pure culture and in syntrophic coculture. Arch. Microbiol. 174:314-321.[CrossRef][Medline]
- Hederstedt, L. 2002. Succinate:quinone oxidoreductase in the bacteria Paracoccus denitrificans and Bacillus subtilis. Biochim. Biophys. Acta 1553:74-83.[Medline]
- Hungate, R. E. 1969. A roll tube method for cultivation of strict anaerobes. Methods Microbiol. 3B:117-132.
- Janausch, I. G., E. Zientz, Q. H. Tran, A. Kroger, and G. Unden. 2002. C4-dicarboxylate carriers and sensors in bacteria. Biochim. Biophys. Acta 1553:39-56.[Medline]
- Kim, B. C., C. Leang, Y. H. Ding, R. H. Glaven, M. V. Coppi, and D. R. Lovley. 2005. OmcF, a putative c-type monoheme outer membrane cytochrome required for the expression of other outer membrane cytochromes in Geobacter sulfurreducens. J. Bacteriol. 187:4505-4513.[Abstract/Free Full Text]
- Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M. Roop II, and K. M. Peterson. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-176.[CrossRef][Medline]
- Kroger, A., S. Biel, J. Simon, R. Gross, G. Unden, and C. R. Lancaster. 2002. Fumarate respiration of Wolinella succinogenes: enzymology, energetics and coupling mechanism. Biochim. Biophys. Acta 1553:23-38.[Medline]
- Lancaster, C. R. 2001. Succinate:quinone oxidoreductases, p. 379-401. In A. Messerschmidt, R. Huber, T. Poulos, and K. Wieghardt (ed.), Handbook of metalloproteins. John Wiley & Sons, Ltd., Chichester, England.
- Lancaster, C. R., A. Kroger, M. Auer, and H. Michel. 1999. Structure of fumarate reductase from Wolinella succinogenes at 2.2 A resolution. Nature 402:377-385.[CrossRef][Medline]
- Lancaster, C. R., and J. Simon. 2002. Succinate:quinone oxidoreductases from epsilon-proteobacteria. Biochim. Biophys. Acta 1553:84-101.[Medline]
- Lane, D. L. 1991. 16S/23S rRNA sequencing, p. 115-175. In E. Stackebrandt and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. Wiley, Chichester, England.
- Leang, C., M. V. Coppi, and D. R. Lovley. 2003. OmcB, a c-type polyheme cytochrome, involved in Fe(III) reduction in Geobacter sulfurreducens. J. Bacteriol. 185:2096-2103.[Abstract/Free Full Text]
- Lemos, R. S., A. S. Fernandes, M. M. Pereira, C. M. Gomes, and M. Teixeira. 2002. Quinol:fumarate oxidoreductases and succinate:quinone oxidoreductases: phylogenetic relationships, metal centres and membrane attachment. Biochim. Biophys. Acta 1553:158-170.[Medline]
- Lemos, R. S., C. M. Gomes, J. LeGall, A. V. Xavier, and M. Teixeira. 2002. The quinol:fumarate oxidoreductase from the sulphate reducing bacterium Desulfovibrio gigas: spectroscopic and redox studies. J. Bioenerg. Biomembr. 34:21-30.[CrossRef][Medline]
- Lloyd, J. R., C. Leang, A. L. Hodges Myerson, M. V. Coppi, S. Cuifo, B. Methe, S. J. Sandler, and D. R. Lovley. 2003. Biochemical and genetic characterization of PpcA, a periplasmic c-type cytochrome in Geobacter sulfurreducens. Biochem. J. 369:153-161.[CrossRef][Medline]
- Lovley, D. R., and F. H. Chapelle. 1995. Deep subsurface microbial processes. Rev. Geophys. 33:365-381.
- Lovley, D. R., J. D. Coates, E. L. Blunt-Harris, E. J. Phillips, and J. C. Woodward. 1996. Humic substances as electron acceptors for microbial respiration. Nature 382:445-448.[CrossRef]
- Lovley, D. R., S. J. Giovannoni, D. C. White, J. E. Champine, E. J. Phillips, Y. A. Gorby, and S. Goodwin. 1993. Geobacter metallireducens gen. nov. sp. nov., a microorganism capable of coupling the complete oxidation of organic compounds to the reduction of iron and other metals. Arch. Microbiol. 159:336-344.[CrossRef][Medline]
- Lovley, D. R., D. E. Holmes, and K. P. Nevin. 2004. Dissimilatory Fe(III) and Mn(IV) reduction. Adv. Microb. Physiol. 49:219-286.[Medline]
- Lovley, D. R., and E. J. Phillips. 1988. Novel mode of microbial energy metabolism: organic carbon oxidation coupled to dissimilatory reduction of iron or manganese. Appl. Environ. Microbiol. 54:1472-1480.[Abstract/Free Full Text]
- Lovley, D. R., E. J. Phillips, Y. A. Gorby, and E. R. Landa. 1991. Microbial reduction of uranium. Nature 350:413-416.[CrossRef]
- Lovley, D. R., J. F. Stolz, G. L. Nord, and E. J. Phillips. 1987. Anaerobic production of magnetite by a dissimilatory iron-reducing microorganism. Nature 330:252-254.[CrossRef]
- Maier, T. M., J. M. Myers, and C. R. Myers. 2003. Identification of the gene encoding the sole physiological fumarate reductase in Shewanella oneidensis MR-1. J. Basic Microbiol. 43:312-327.[CrossRef][Medline]
- Methe, B. A., K. E. Nelson, J. A. Eisen, I. T. Paulsen, W. Nelson, J. F. Heidelberg, D. Wu, M. Wu, N. Ward, M. J. Beanan, R. J. Dodson, R. Madupu, L. M. Brinkac, S. C. Daugherty, R. T. DeBoy, A. S. Durkin, M. Gwinn, J. F. Kolonay, S. A. Sullivan, D. H. Haft, J. Selengut, T. M. Davidsen, N. Zafar, O. White, B. Tran, C. Romero, H. A. Forberger, J. Weidman, H. Khouri, T. V. Feldblyum, T. R. Utterback, S. E. Van Aken, D. R. Lovley, and C. M. Fraser. 2003. Genome of Geobacter sulfurreducens: metal reduction in subsurface environments. Science 302:1967-1969.[Abstract/Free Full Text]
- Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425.[Abstract]
- Schirawski, J., T. Hankeln, and G. Unden. 1998. Expression of the succinate dehydrogenase genes (sdhCAB) from the facultatively anaerobic Paenibacillus macerans during aerobic growth. Arch. Microbiol. 170:304-308.[CrossRef][Medline]
- Schirawski, J., and G. Unden. 1998. Menaquinone-dependent succinate dehydrogenase of bacteria catalyzes reversed electron transport driven by the proton potential. Eur. J. Biochem. 257:210-215.[Medline]
- Schnorpfeil, M., I. G. Janausch, S. Biel, A. Kroger, and G. Unden. 2001. Generation of a proton potential by succinate dehydrogenase of Bacillus subtilis functioning as a fumarate reductase. Eur. J. Biochem. 268:3069-3074.[Medline]
- Smith, P. K., R. I. Krohn, G. T. Hermanson, A. K. Mallia, F. H. Gartner, M. D. Provenzano, E. K. Fujimoto, N. M. Goeke, B. J. Olson, and D. C. Klenk. 1985. Measurement of protein using bicinchoninic acid. Anal. Biochem. 150:76-85.[CrossRef][Medline]
- Taylor, P., S. L. Pealing, G. A. Reid, S. K. Chapman, and M. D. Walkinshaw. 1999. Structural and mechanistic mapping of a unique fumarate reductase. Nat. Struct. Biol. 6:1108-1112.[CrossRef][Medline]
- Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
- Ullmann, R., R. Gross, J. Simon, G. Unden, and A. Kroger.2000. Transport of C4-dicarboxylates in Wolinella succinogenes. J. Bacteriol. 182:5757-5764.[Abstract/Free Full Text]
- Wilde, R. J., and J. R. Guest. 1986. Transcript analysis of the citrate synthase and succinate dehydrogenase genes of Escherichia coli K12. J. Gen. Microbiol. 132:3239-3251.[Medline]
Journal of Bacteriology, January 2006, p. 450-455, Vol. 188, No. 2
0021-9193/06/$08.00+0 doi:10.1128/JB.188.2.450-455.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Risso, C., Van Dien, S. J., Orloff, A., Lovley, D. R., Coppi, M. V.
(2008). Elucidation of an Alternate Isoleucine Biosynthesis Pathway in Geobacter sulfurreducens. J. Bacteriol.
190: 2266-2274
[Abstract]
[Full Text]
-
Coppi, M. V., O'Neil, R. A., Leang, C., Kaufmann, F., Methe, B. A., Nevin, K. P., Woodard, T. L., Liu, A., Lovley, D. R.
(2007). Involvement of Geobacter sulfurreducens SfrAB in acetate metabolism rather than intracellular, respiration-linked Fe(III) citrate reduction. Microbiology
153: 3572-3585
[Abstract]
[Full Text]
-
Tang, Y. J., Meadows, A. L., Kirby, J., Keasling, J. D.
(2007). Anaerobic Central Metabolic Pathways in Shewanella oneidensis MR-1 Reinterpreted in the Light of Isotopic Metabolite Labeling. J. Bacteriol.
189: 894-901
[Abstract]
[Full Text]
-
DiDonato, L. N., Sullivan, S. A., Methe, B. A., Nevin, K. P., England, R., Lovley, D. R.
(2006). Role of RelGsu in Stress Response and Fe(III) Reduction in Geobacter sulfurreducens. J. Bacteriol.
188: 8469-8478
[Abstract]
[Full Text]
-
Mahadevan, R., Bond, D. R., Butler, J. E., Esteve-Nunez, A., Coppi, M. V., Palsson, B. O., Schilling, C. H., Lovley, D. R.
(2006). Characterization of Metabolism in the Fe(III)-Reducing Organism Geobacter sulfurreducens by Constraint-Based Modeling. Appl. Environ. Microbiol.
72: 1558-1568
[Abstract]
[Full Text]